Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRNA NCOA3 | |||
Gene | NCOA3 | Organism | Human |
Genome Locus | chr20:47623910-47633636:+ | Build | hg19 |
Disease | PDLSC osteogenis | ICD-10 | Gingivitis and periodontal diseases (K05) |
DBLink | Link to database | PMID | 29197342 |
Experimental Method | |||
Sample Type | Periodontal Ligament Stem Cells (PDLSCs) | Comparison | Periodontal Ligament Stem Cells (PDLSCs) with and without dexamethasone and Vitamin-C induction |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GCAGTCATGGTCCCAGAAACG ReverseCCCGTCTCCGTTTTTCACCAC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Gu, X, Li, M, Jin, Y, Liu, D, Wei, F (2017). Identification and integrated analysis of differentially expressed lncRNAs and circRNAs reveal the potential ceRNA networks during PDLSC osteogenic differentiation. BMC Genet., 18, 1:100. |